View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3361_high_22 (Length: 206)
Name: NF3361_high_22
Description: NF3361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3361_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 45319883 - 45320053
Alignment:
| Q |
18 |
cttgagaaggacccgaaggcattccatgagagagcctatgaggggactgttcttggtttctaatagacgtttcaactctatgaagatcggtatagtgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45319883 |
cttgagaaggacccgaaggcattccatgagagagcctatgaggggactgttcttggtttctaatagacatttcaactctatgaagatcggtatagtgttt |
45319982 |
T |
 |
| Q |
118 |
tgaatgaggcctttcttgactgcctgagttatagcctttctagttgaagatccattttctcccccttcttc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45319983 |
tgaatgaggcctttcttgactgcctgagttatagcctttctagttgaagatccattttctcccccttcttc |
45320053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 14234726 - 14234896
Alignment:
| Q |
18 |
cttgagaaggacccgaaggcattccatgagagagcctatgaggggactgttcttggtttctaatagacgtttcaactctatgaagatcggtatagtgttt |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14234726 |
cttgagaaggatccgaaggcattccatgagagagcctatgaggggactgttcttggtttccaatagacgtttcaactctatgaagatgggtatagtgttt |
14234825 |
T |
 |
| Q |
118 |
tgaatgaggcctttcttgactgcctgagttatagcctttctagttgaagatccattttctcccccttcttc |
188 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
14234826 |
tgaatgaggcccttcttgactgcctgagttatagcttttctagttgaagatccattttctcctccttcttc |
14234896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University