View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3361_high_7 (Length: 358)
Name: NF3361_high_7
Description: NF3361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3361_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 24 - 343
Target Start/End: Complemental strand, 18096008 - 18095694
Alignment:
| Q |
24 |
attggcatagtcattgttgttgcccacttgaaaaggaaagagattggcgttggcattgttaccaccacccacttgaacaggaaaaagattggcattttca |
123 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18096008 |
attggcattgtcattgttgttgcccacttgaaaaggaaagagattggcgttggcattgttaccaccacccacttgaaaaggaaaaagattggcattttca |
18095909 |
T |
|
| Q |
124 |
tcacccacatcaccctctagaaaagcaatgtcattgacattgatttcgttaccaccacccatttgaaaaggaaaaggaaattgattggcattgtcacctt |
223 |
Q |
| |
|
|||||||| | | | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18095908 |
tcacccacttgaa-----aaaaaagcaaagtcattgacattgatttcgttaccaccacccatttgaaaaggaaaaggaaattgattggcattgtcacctt |
18095814 |
T |
|
| Q |
224 |
gctgttgaagaggaagtggccattccaaattagccctaatttcaaacctttcaccagaaaggatggaaagagattgctgaatgggaaaccctgactgttc |
323 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18095813 |
gctgttgaagaggaagtggccaatccaaattagccctaatttcaaacctttcaccagaaaggatggaaagagattgctgaatgggaaaccctgactgttc |
18095714 |
T |
|
| Q |
324 |
aaatacgaggagacgtgttt |
343 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
18095713 |
caataagaggagacgtgttt |
18095694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 207 - 312
Target Start/End: Complemental strand, 18081613 - 18081508
Alignment:
| Q |
207 |
attggcattgtcaccttgctgttgaagaggaagtggccattccaaattagccctaatttcaaacctttcaccagaaaggatggaaagagattgctgaatg |
306 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||| ||||| | |||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
18081613 |
attggcattgttaccttgttgttgaagaggaagtggccattccaaattaaccctattctcaaacctatcaccagaaaggatggaaagggattgctgaatg |
18081514 |
T |
|
| Q |
307 |
ggaaac |
312 |
Q |
| |
|
| |||| |
|
|
| T |
18081513 |
gtaaac |
18081508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 226 - 338
Target Start/End: Original strand, 18140096 - 18140208
Alignment:
| Q |
226 |
tgttgaagaggaagtggccattccaaattagccctaatttcaaacctttcaccagaaaggatggaaagagattgctgaatgggaaaccctgactgttcaa |
325 |
Q |
| |
|
||||||| |||||||| || || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||| | |
|
|
| T |
18140096 |
tgttgaaatggaagtgggcaatctaaattagccctaatttcaaacctttcaccagaaagaatggaaagagattgctgaatgtgaaaccctgaccgttcca |
18140195 |
T |
|
| Q |
326 |
atacgaggagacg |
338 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
18140196 |
atatgaggagacg |
18140208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University