View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3361_low_22 (Length: 235)

Name: NF3361_low_22
Description: NF3361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3361_low_22
NF3361_low_22
[»] chr1 (1 HSPs)
chr1 (1-221)||(43843282-43843494)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 43843282 - 43843494
Alignment:
1 tctcaaatctcaaaccccattactttaactcgttttatatcaaaattttgcatttcttaattatttattaattagtttaaagannnnnnnnnnnnnnnnn 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                     
43843282 tctcaaatctcaaaccccattactttaactcgttttatatcaaaattttgcatttcttaattatttattaattagtttaaagatttttttttt------- 43843374  T
101 gtggctaaattagttgatccacgatgatatatagtgtatacnnnnnnnngcaggcttaattaggtgtggtggtggtactcgtgatggtcttgctctatgg 200  Q
     |||||||||||||| |||||||||||||||||||||||||        |||||||||||||||| ||||||||||||||| ||||||||||||||||||    
43843375 -tggctaaattagttaatccacgatgatatatagtgtatacttttttttgcaggcttaattaggtctggtggtggtactcgagatggtcttgctctatgg 43843473  T
201 ccagggattcagaataatatt 221  Q
    |||||||||||||||||||||    
43843474 ccagggattcagaataatatt 43843494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University