View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3361_low_24 (Length: 206)
Name: NF3361_low_24
Description: NF3361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3361_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 16281947 - 16281776
Alignment:
| Q |
15 |
cagagagtaaactgaaaattgaaactaacctcgtgattttgaaattcagaaattacactacattagaatctcaatttagaaattaaaactaacgttacaa |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16281947 |
cagaaagtaaactgaaaattgaaactaaactcgtgattttgaaattccgaaattacactacattagaatctcaatttagaaattaaaactaacgttacaa |
16281848 |
T |
|
| Q |
115 |
ttttaaaaatgaaagtaacacatagaatctcaattttcagagcgaaatgaaaatctaacagtaacatacgaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16281847 |
ttttaaaaatgaaagtaacacatagaatctcaattttcagagcgaaatgaaaatctaacagtaacatacgaa |
16281776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 180
Target Start/End: Complemental strand, 16282452 - 16282404
Alignment:
| Q |
132 |
acacatagaatctcaattttcagagcgaaatgaaaatctaacagtaaca |
180 |
Q |
| |
|
||||||||||||||||||||||||| |||||| || |||||||||||| |
|
|
| T |
16282452 |
acacatagaatctcaattttcagagtgaaatgtaatgctaacagtaaca |
16282404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University