View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3363_high_28 (Length: 254)
Name: NF3363_high_28
Description: NF3363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3363_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 29620113 - 29619885
Alignment:
| Q |
18 |
gttaagaaggtcaattannnnnnnngtactctcactttgcttcccttttctttctctaacaaggtttccaacagccactgtttctacctcaagatcctca |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29620113 |
gttaagaaggtcaattattttttttgtactctcactttgcttcccttttctttctctaacaaggtttccaacagccactgtttctacctcaagatcctca |
29620014 |
T |
 |
| Q |
118 |
acactacgaagctccaacttctttgcaagcctttcgataatggcactatcggcattacgatcatcttcatcagagaacaccaccatcatatccattgcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29620013 |
acactacgaagctccaacttctttgcaagcctttcgataatggcactatcggcattacgatcatcttcatcagagaacaccaccatcatatccattgcta |
29619914 |
T |
 |
| Q |
218 |
gctctatgtcttgtgtatcagttcatctc |
246 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
29619913 |
gctctatgtcttgtgtatcagttcttctc |
29619885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University