View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3363_high_31 (Length: 250)
Name: NF3363_high_31
Description: NF3363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3363_high_31 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 34700756 - 34700985
Alignment:
| Q |
19 |
ttaagaatgttttcaaaataatatacactcaaacgtctttcataaatgacaaaactacgagggcttatatataagatgcatagaaaacaatgtccggtaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34700756 |
ttaagaatgttttcaaaataatatacactcaaacgtctttcacaaatgacaaaactacgagggcttata--taagatgcatagaaaacaatgtccggtaa |
34700853 |
T |
|
| Q |
119 |
acaaggtgatgtgaacttgaggtttaagaatcgcacaccaggcggttgagctcaaacctatgccactctttagggctaataaaccctttaaccgttaatt |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34700854 |
acgaggtgatgtgaacttgaggtttaagaatcgcacaccaggcggttgagctcaaacctatgccactctttagggctaataaaccctttaaccgttaatt |
34700953 |
T |
|
| Q |
219 |
agctaccgttctcgtacacaaagttttacatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34700954 |
agctaccgttctcgtacacaaagttttacatt |
34700985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University