View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3363_low_15 (Length: 341)
Name: NF3363_low_15
Description: NF3363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3363_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 12 - 325
Target Start/End: Original strand, 40510395 - 40510708
Alignment:
| Q |
12 |
atgaaggagactatgcgcaaattccaaactttcttagcaaactttgaggtaatgcaaatctttctttgtatatggcagattcctgtaagttgtaagcagt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40510395 |
atgaaggagactatgcgcaaattccaaactttcttagcaaactttgaggtaatgcaaatctttctctgtatatggcagattcctgtaagttgtaagcagt |
40510494 |
T |
 |
| Q |
112 |
tgttagctagcagccagtcattagttgtttcttcattctgttaattcacatctttctttttatctctagggagtaatacttgtggaattaaatagaagat |
211 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40510495 |
tattagctagcagccagttattagttgtttcttcgttctgttaattcacatctttctttttatctctagggagtaatacttgtggaattaaatagaagat |
40510594 |
T |
 |
| Q |
212 |
attcccttccaattgccctagacatgagtcaaggctgtcctaaatctgatgcgtggtcccttctgacaaggctgaagtcttatcaccctgcacaagctct |
311 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40510595 |
attcccttccaattgcccttgacatgagtcaaggctgtcctaaatctgatgcgtggtcccttctgacaaggctgaagtcttatcaccctgcacaagctct |
40510694 |
T |
 |
| Q |
312 |
aaaccatttccctt |
325 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40510695 |
aaaccatttccctt |
40510708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University