View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3363_low_26 (Length: 271)
Name: NF3363_low_26
Description: NF3363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3363_low_26 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 145 - 271
Target Start/End: Original strand, 31741762 - 31741888
Alignment:
| Q |
145 |
ataaaagggatgtcttttatttttatggtcatctatttttaggaatcttgagtctagagtgaatattgtgtatgatgttgtggtaataatttatcctggt |
244 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31741762 |
ataaaagggatatcttttatttttatggtcatctatttttaggaatcttgagtctagagtgaatattgtgtatgatgttgtggtaataatttatcctggt |
31741861 |
T |
|
| Q |
245 |
tatttggatttcagtttgcattttgcc |
271 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31741862 |
tatttggatttcagtttgcattttgcc |
31741888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 31741865 - 31741762
Alignment:
| Q |
1 |
aataaccaggataaattattaccacaacatcatacacaatattcactctagactcaagattcctaaaaatagatgaccataaaaataaaagacatccctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31741865 |
aataaccaggataaattattaccacaacatcatacacaatattcactctagactcaagattcctaaaaatagatgaccataaaaataaaagatatccctt |
31741766 |
T |
|
| Q |
101 |
ttat |
104 |
Q |
| |
|
|||| |
|
|
| T |
31741765 |
ttat |
31741762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University