View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3363_low_35 (Length: 246)
Name: NF3363_low_35
Description: NF3363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3363_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 26441185 - 26440952
Alignment:
| Q |
1 |
taactgatgtggtaatgacaacacgacaaaatactatcactttttg-attaaaaatagtgaacaatactctttcacaaaaaccacatgcaaaacaacaat |
99 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26441185 |
taactgatgtggcaatgacaacacgacaaaatactatcactttttttattaaaaatagtgaacaatactctttcacaaaaaccacatgcaaaacaacgat |
26441086 |
T |
 |
| Q |
100 |
ggttgagatccaacagcaaaaatgttaattacctgttttgtgaagtagttctttctcaagattgttgatacgatgaattattgtctccttttctgacaac |
199 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26441085 |
ggttgagatccaacaacaaaaatgttaattacctgttttgtgaagtagttctttctcaagattgttgatacgatgaattattgtctccttttctgacaac |
26440986 |
T |
 |
| Q |
200 |
aaagaggttttctgatcttgttctgattcaattt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26440985 |
aaagaggttttctgatcttgttctgattcaattt |
26440952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University