View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3363_low_41 (Length: 235)
Name: NF3363_low_41
Description: NF3363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3363_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 118 - 220
Target Start/End: Complemental strand, 6222050 - 6221948
Alignment:
| Q |
118 |
acgaattcaagtatcaacagtttaatgatttttctcatgaaatgttgatgttataaggtagcttatttaaactacttcaaccttttttattttctttgct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6222050 |
acgaattcaagtatcaacagtttaatgatttttctcatgaaatgttgatgttataaggtagcttatttaaactacttcaaccttttttattttctttgct |
6221951 |
T |
|
| Q |
218 |
agt |
220 |
Q |
| |
|
||| |
|
|
| T |
6221950 |
agt |
6221948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 78 - 122
Target Start/End: Complemental strand, 6222180 - 6222136
Alignment:
| Q |
78 |
tatgcaccacgtgcacaatccaatgagttcacgtatggacacgaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
6222180 |
tatgcaccacgtgcacaatccaatgaatttacgtatggacacgaa |
6222136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University