View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3364_high_8 (Length: 263)

Name: NF3364_high_8
Description: NF3364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3364_high_8
NF3364_high_8
[»] chr6 (1 HSPs)
chr6 (60-249)||(10969351-10969538)


Alignment Details
Target: chr6 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 60 - 249
Target Start/End: Complemental strand, 10969538 - 10969351
Alignment:
60 aacccttctatccaaattttgttttgaaatttgctatgcaagatggagtgtccccctcgtacccgattttgatagttcccacacaaggaatggggtgggg 159  Q
    |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10969538 aacccttctacccaaattttgttttgaaatttcctatgcaagatggagtgtccccctcgtacccgattttgatagttcccacacaaggaatggggtgggg 10969439  T
160 gaacgtgtcaggtagtattaaggtgtgagcatgtgcttgattccattccatttcaagtattaccattttcttgtggttgcggatgatgat 249  Q
    |||||||||||||||||||||||||||||||  |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||    
10969438 gaacgtgtcaggtagtattaaggtgtgagca--tgcttgattccattccatatgaagtattaccattttcttgtggttgcggatgatgat 10969351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University