View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3364_low_5 (Length: 319)
Name: NF3364_low_5
Description: NF3364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3364_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 153 - 306
Target Start/End: Original strand, 399929 - 400083
Alignment:
| Q |
153 |
aacccaagtgatgctttcatcgcaaatcaatctgtctcatatggactattattgtatttgtttgtttcttggtaccttc-ggggttaggcatgcatgacc |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
399929 |
aacccaagtgatgctttcatcccaaatcaatctgtctcatatggactattattgtatttgtttgtttcttggtaccttcgggggttaggcatgcatgacc |
400028 |
T |
 |
| Q |
252 |
aattgtagcaatgccccgtcttacaagtaaaaccaattaaattttcatccctatc |
306 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
400029 |
aattgtagtaatgccccgtcttacaagtaaaaccaattaaattttcatccctatc |
400083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 12 - 158
Target Start/End: Original strand, 399764 - 399910
Alignment:
| Q |
12 |
tcaatttcattttttgttgctatgctgaaagtatagactttatctttcacttacaaaataaagaacttattttttgtgtttgacgttgaaatttaaactt |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
399764 |
tcaattttattttttgttgctatgctgaaagtatagactttatctttcacttacaaaataaagaacttcttttttgtgtttgacgttgaaatttaaactt |
399863 |
T |
 |
| Q |
112 |
gttttaaagtcaaccaaactataacaagccaatggcatatgaaccca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
399864 |
gttttaaagtcaaccaaactataacaagccaatggcatttgaaccca |
399910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University