View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3364_low_9 (Length: 263)
Name: NF3364_low_9
Description: NF3364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3364_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 60 - 249
Target Start/End: Complemental strand, 10969538 - 10969351
Alignment:
| Q |
60 |
aacccttctatccaaattttgttttgaaatttgctatgcaagatggagtgtccccctcgtacccgattttgatagttcccacacaaggaatggggtgggg |
159 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10969538 |
aacccttctacccaaattttgttttgaaatttcctatgcaagatggagtgtccccctcgtacccgattttgatagttcccacacaaggaatggggtgggg |
10969439 |
T |
 |
| Q |
160 |
gaacgtgtcaggtagtattaaggtgtgagcatgtgcttgattccattccatttcaagtattaccattttcttgtggttgcggatgatgat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10969438 |
gaacgtgtcaggtagtattaaggtgtgagca--tgcttgattccattccatatgaagtattaccattttcttgtggttgcggatgatgat |
10969351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University