View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_107 (Length: 225)
Name: NF3365_high_107
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_107 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 29 - 222
Target Start/End: Complemental strand, 52512336 - 52512143
Alignment:
| Q |
29 |
gagatgaagaataataatattgacgagcacaaggatatgaatgctctcatgctcaagacactttttacaggaggagaattttataacgctgaaaattatc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512336 |
gagatgaagaataataatattgacgagcacaaggatatgaatgctctcatgctcaagacactttttacaggaggagaattttataacgctgaaaattatc |
52512237 |
T |
 |
| Q |
129 |
ctaactttggagacacaagtattccaactccaagtagaggcaacaataatattagtagccagattcacccgagcatcgatatatcaaacttgaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512236 |
ctaactttggagacacaagtattccaactccaagtagaggcaacaataatattagtagccagattcacccgagcatcgatatatcaaacttgaa |
52512143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University