View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3365_high_110 (Length: 222)

Name: NF3365_high_110
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3365_high_110
NF3365_high_110
[»] scaffold0239 (1 HSPs)
scaffold0239 (14-203)||(5025-5214)


Alignment Details
Target: scaffold0239 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0239
Description:

Target: scaffold0239; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 5214 - 5025
Alignment:
14 tgagatgaatgctgcattaactaaacccaatcccccttgggcctatgttcatacataatagtttattctgcctcaattatactaaaatttgtagtataaa 113  Q
    ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||    
5214 tgagatgaatgctacattaactaaacccaatccccattgggcctatgttcatacataattgtttattctgcctcaattgtactaaaatttatagtataaa 5115  T
114 ggcaacatataaacgatgtctaaaaaagaagaatatacagttgcaattatgtttacacttacgataattagaaacaatagctagccggaa 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5114 ggcaacatataaacgatgtctaaaaaagaagaatatacagttgcaattatgtttacacttacgataattagaaacaatagctagccggaa 5025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University