View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3365_high_114 (Length: 213)

Name: NF3365_high_114
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3365_high_114
NF3365_high_114
[»] chr5 (1 HSPs)
chr5 (17-191)||(5429144-5429325)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 5429325 - 5429144
Alignment:
17 aatataatggacataaagtcatggtgacnnnnnnnnggactcaaagtcaatataaacatacaaattaaatcaagggaaaaaa--taaataattaagaaga 114  Q
    ||||||||||||||||||||||||||||        | ||||||||||||||||||||||||||||||||| ||||||||||  ||||||| ||||||||    
5429325 aatataatggacataaagtcatggtgacttttttttg-actcaaagtcaatataaacatacaaattaaatccagggaaaaaaaataaataaataagaaga 5429227  T
115 tgataagaaataagaatttcaaaacggagcttttccctctcacatccat------aaaccatagattttgaaaatgtacaagt 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||    
5429226 tgataagaaataagaatttcaaaacggagcttttccctctcacatccataaacataaaccatagattttgaaaatgtacaagt 5429144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University