View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_13 (Length: 462)
Name: NF3365_high_13
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_13 |
 |  |
|
| [»] scaffold0160 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0160 (Bit Score: 72; Significance: 1e-32; HSPs: 4)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 108 - 179
Target Start/End: Complemental strand, 20818 - 20747
Alignment:
| Q |
108 |
cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatcttcaattaaatatcaataa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20818 |
cgggcaagtctggcatgttacatgtttcttctctcacttcctgcatgtccatcttcaattaaatatcaataa |
20747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 385 - 444
Target Start/End: Complemental strand, 20539 - 20480
Alignment:
| Q |
385 |
gttttcttagtttcatccttttatggataaatacaagtgcaaactttgctatagaagctt |
444 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20539 |
gtttttttagtttcatccttttatggataaatacaagtgcaaactttgctatagaagctt |
20480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 253 - 298
Target Start/End: Complemental strand, 20674 - 20629
Alignment:
| Q |
253 |
cttagtgaagaggaatgcttgtcacctactccttttatagtttcta |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20674 |
cttagtgaagaggaatgcttgtcacctactccttttatagtttcta |
20629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 321 - 362
Target Start/End: Complemental strand, 20606 - 20565
Alignment:
| Q |
321 |
aaaaccaaacaaattcatcataataataaaagttaactttgt |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20606 |
aaaaccaaacaaattcatcataataataaaagttaactttgt |
20565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University