View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_15 (Length: 458)
Name: NF3365_high_15
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 402 - 450
Target Start/End: Complemental strand, 9113786 - 9113738
Alignment:
| Q |
402 |
aaatatttaattaatactatgtaatttctttttccacgttcttcatctc |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9113786 |
aaatatttaattaatactatgtaatttctttttccacgttcttcatctc |
9113738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 9113835 - 9113787
Alignment:
| Q |
19 |
gtttctttcttggcttggtggaaagaaaaatttaagttaccacgaggtc |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9113835 |
gtttctttcttggcttggtggaaagaaaaatttaagttaccacgaggtc |
9113787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University