View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_80 (Length: 249)
Name: NF3365_high_80
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_80 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 8)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 65 - 232
Target Start/End: Complemental strand, 4875027 - 4874859
Alignment:
| Q |
65 |
gaagaatttaaatccgatctacctcttctcggtttcaattagctctattaggaaattaatcaagctt-gcaatnnnnnnnnnnnnttatatgtgtgactt |
163 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
4875027 |
gaagaatttaaatccgatctacctcctctcggtttcaattagctctattaggaaattaatcaagcttggcaataaaaagaaaaaatgatatgtgtgactt |
4874928 |
T |
 |
| Q |
164 |
ttttcggtataaggtcacacctacactcgatgatgaaggacccatatagcgtacaactatgccttcttt |
232 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
4874927 |
ttttgagtataaggtcacacccacactcgatgatgaaggacctgtatagcgtacaactatgctttcttt |
4874859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 170 - 232
Target Start/End: Complemental strand, 4874075 - 4874013
Alignment:
| Q |
170 |
gtataaggtcacacctacactcgatgatgaaggacccatatagcgtacaactatgccttcttt |
232 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4874075 |
gtataaggtcacacctacagtcgatgatgaaggacctatatagcgtacaactatgccttcttt |
4874013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 65 - 117
Target Start/End: Complemental strand, 4874136 - 4874084
Alignment:
| Q |
65 |
gaagaatttaaatccgatctacctcttctcggtttcaattagctctattagga |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
4874136 |
gaagaatttaaatccgatctacctcatctcggtttcaattatctctattagga |
4874084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 91 - 129
Target Start/End: Complemental strand, 4893795 - 4893757
Alignment:
| Q |
91 |
tctcggtttcaattagctctattaggaaattaatcaagc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4893795 |
tctcggtttcaattagctctattaggaaattaatcaagc |
4893757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 65 - 124
Target Start/End: Complemental strand, 4883994 - 4883937
Alignment:
| Q |
65 |
gaagaatttaaatccgatctacctcttctcggtttcaattagctctattaggaaattaat |
124 |
Q |
| |
|
||||||||| ||||| |||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
4883994 |
gaagaatttgaatcc--tctacctcatctcggtttcaattagccctattaggaaattaat |
4883937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 191
Target Start/End: Complemental strand, 4893734 - 4893694
Alignment:
| Q |
151 |
atatgtgtgacttttttcggtataaggtcacacctacactc |
191 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
4893734 |
atatgtgtgacttttttcagtataaggtcacacccacactc |
4893694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 171 - 205
Target Start/End: Original strand, 4646422 - 4646456
Alignment:
| Q |
171 |
tataaggtcacacctacactcgatgatgaaggacc |
205 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
4646422 |
tataaggtcacacccacactcgatgatgaaggacc |
4646456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 82 - 126
Target Start/End: Original strand, 4646334 - 4646378
Alignment:
| Q |
82 |
tctacctcttctcggtttcaattagctctattaggaaattaatca |
126 |
Q |
| |
|
|||||||| | || |||||||||||| |||||||||||||||||| |
|
|
| T |
4646334 |
tctacctcctgtcagtttcaattagccctattaggaaattaatca |
4646378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 91 - 129
Target Start/End: Original strand, 9112571 - 9112609
Alignment:
| Q |
91 |
tctcggtttcaattagctctattaggaaattaatcaagc |
129 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9112571 |
tctcgatttcaattagccctattaggaaattaatcaagc |
9112609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University