View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_84 (Length: 248)
Name: NF3365_high_84
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_84 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 92 - 222
Target Start/End: Original strand, 29727079 - 29727209
Alignment:
| Q |
92 |
gtttagctgcaaaaagagtccaaatagataatgcacaatagaagaaatccaaataccacttaatgcatcccttagagttactccaaactaaagtcattca |
191 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29727079 |
gtttagctgctaaaagaatgcaaatagataatgcactagagaagaaatccaaataccacttaatgcatcccttagagttactcgaaactaaagtcattca |
29727178 |
T |
|
| Q |
192 |
aatgaaaactgtttattggcaaatgaaagaa |
222 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
29727179 |
aatgaaaactgtttactggcaaatgaaagaa |
29727209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University