View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_87 (Length: 244)
Name: NF3365_high_87
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_87 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 42 - 187
Target Start/End: Complemental strand, 54818873 - 54818728
Alignment:
| Q |
42 |
tcaagtaatcttgcagctataattcatcttttaagatagataaataattttgcggctcaacaacttctataatttattctaaatcatattcattttcatt |
141 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
54818873 |
tcaagtaatcttgcatctaaaattcatcttttaagatagataaataattttgcggctcaacaacttctataatttattctaaatcttattcattctcatt |
54818774 |
T |
 |
| Q |
142 |
ttccttaacttttaaatttattggacggcaaactagtaatataaga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54818773 |
ttccttaacttttaaatttattggacggcaaactagtaatataaga |
54818728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University