View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_89 (Length: 242)
Name: NF3365_high_89
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_89 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 26833548 - 26833324
Alignment:
| Q |
1 |
ttttggatatcgttttgatttgttatagttttgtttttcaatgttaatgattctggtttacactcttggttctcttttggggaccaaaagttccaaaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833548 |
ttttggatatcgttttgatttgttatagttttgtttttcaatgttaatgattctggtttacactcttggttctcttttggggaccaaaagttccaaaatc |
26833449 |
T |
 |
| Q |
101 |
atttaaaatcgagatattaaaattgaaattaaaaagtgtaattcaccctactcacttgaacgaaatcaataagatgatggatcatgacttggtggcttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833448 |
atttaaaatcgagatattaaaattgaaattaaaaagtgtaattcaccctactcacttgaaggaaatcaataagatgatggatcatgacttggtggcttta |
26833349 |
T |
 |
| Q |
201 |
aagagagtgggtgataaaggagctg |
225 |
Q |
| |
|
|||||||||||||| |||| ||||| |
|
|
| T |
26833348 |
aagagagtgggtgagaaagaagctg |
26833324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University