View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_92 (Length: 239)
Name: NF3365_high_92
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_92 |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0459 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0366 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 66 - 223
Target Start/End: Complemental strand, 8677 - 8520
Alignment:
| Q |
66 |
acaggatattggcaccgactatgtatattttctttgcttctgctctacctgttattgccttcggcgcgcagctcagtagggaaacaggttggttcattct |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8677 |
acaggatattggcaccgactatgtatattttctttgcttctgctctacctgttattgccttcggcgcgcagctcagtagggaaacaggttggttcattct |
8578 |
T |
 |
| Q |
166 |
ttcttgatcattatgtcctttcactctgacctaatgcactcactctatgcataacttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8577 |
ttcttgatcattatgtcctttcactctgacctaatgcactcactctatgcataacttt |
8520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 66 - 223
Target Start/End: Complemental strand, 8753 - 8596
Alignment:
| Q |
66 |
acaggatattggcaccgactatgtatattttctttgcttctgctctacctgttattgccttcggcgcgcagctcagtagggaaacaggttggttcattct |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8753 |
acaggatattggcaccgactatgtatattttctttgcttctgctctacctgttattgccttcggcgcgcagctcagtagggaaacatgttggttcattct |
8654 |
T |
 |
| Q |
166 |
ttcttgatcattatgtcctttcactctgacctaatgcactcactctatgcataacttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8653 |
ttcttgatcattatgtcctttcactctgacctaatgcactcactctatgcataacttt |
8596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University