View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_93 (Length: 238)
Name: NF3365_high_93
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 31722432 - 31722645
Alignment:
| Q |
17 |
ataatagccattaaatatcacagcttcaaacaaatcagctgattagccatccctaaattaaaattaattttgatctgctaatgatgtttgatttagtttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31722432 |
ataatagccattaaatatcacagcttcaaacaaatcagctgattagccatccctaaattaaaattaattttgatctgctaatgatgtttgatttagtttg |
31722531 |
T |
 |
| Q |
117 |
taaggtactgaattcaactttcactgactgccatcttcggccatctgttgtaattgcttttattttaaaattagttttgatgtataggccgaaataagta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31722532 |
taaggtactgaattcaactttcactgactgccatcttcggccatctgttgtaattgcttttattttaaaattagttttgatgtataggccgaaataagta |
31722631 |
T |
 |
| Q |
217 |
tgttaaagttatat |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31722632 |
tgttaaagttatat |
31722645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University