View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_high_94 (Length: 237)
Name: NF3365_high_94
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_high_94 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 3157989 - 3157914
Alignment:
| Q |
1 |
atttgatgcggtgggagtataagcaaaattcactatattttttcaaaagaagataagtaaatatattattttcctc |
76 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3157989 |
atttgatgctgtgggagtataagcaaaactcactatattttttcaaaagaagataactaaatatattattttcctc |
3157914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 166 - 221
Target Start/End: Complemental strand, 3157824 - 3157769
Alignment:
| Q |
166 |
tcaacaaaatatattagttgtgaaagatgatataaactatgtcctcgtgagcttag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
3157824 |
tcaacaaaatatattagttgtgaaagatgatatatgctatatcctcgtgagcttag |
3157769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University