View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_101 (Length: 234)
Name: NF3365_low_101
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_101 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 35207240 - 35207447
Alignment:
| Q |
14 |
gagacgtacactgttaacattttgtccaaaaacactatgcaacaaattgcatcggttttcctcaacaagacattaatcaactagccttaggtagaaaatc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35207240 |
gagacgtacactgttaacattttgtccaaaaacactatgcaacaaattgcatcggttttcctaaacaagacattaatcaactagccttacgtagaaaatc |
35207339 |
T |
 |
| Q |
114 |
tttcgatatatgtttgcacatcaagatgtacaaatatgtccaaatgtaaaagcaaccattcattg-aaaaaatgcacattttagcttaaataaaacatgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35207340 |
tttcgatatatgtttgcacatcaagatgtacaaatatgtccaaatgtaaaagcaaccattcattgaaaaaaatgcacattttagcttaaataaaacatgt |
35207439 |
T |
 |
| Q |
213 |
gaattatt |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
35207440 |
gaattatt |
35207447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University