View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_106 (Length: 227)
Name: NF3365_low_106
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_106 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 3911063 - 3911284
Alignment:
| Q |
6 |
agatgagtgtctttactagtgtatgacccatttccccacaaactcacacagataatggcatagcaaaactgcaaagaaagtgacatctgagaatcaaaag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3911063 |
agatgagtgtctttactagtgtatgacccatttccccacaaactcacacagataatggcatagcaaaactgcaaagaaagtgacatctgagaatcaaaag |
3911162 |
T |
|
| Q |
106 |
ttaaatccaacgacacaccacaccttactgttcactgtgttatttacttctaccatgtctcaactcaaccacattgtcatagatagcacttgcatataca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3911163 |
ttaaatccaacgacacaccacaccttactgttcactgtgttatttacttctaccatgtctcaactcaaccacattgtcatagatagcacttgcatataca |
3911262 |
T |
|
| Q |
206 |
taacagtttaaagaaagagaaa |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3911263 |
taacagtttaaagaaagagaaa |
3911284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University