View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_112 (Length: 222)
Name: NF3365_low_112
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_112 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 298365 - 298180
Alignment:
| Q |
15 |
gagatgaacataagtagtcataatgacatgtttctgaacacaatctcatcaatatcatcttcactaaccatcaataacagagtgtacaataataccggta |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
298365 |
gagaagaacataagtagtcataatgacatgtttctgaacacaatctcatcaatatcatcttcactaactatcaataacagagtgtacaataagaccggta |
298266 |
T |
 |
| Q |
115 |
ctagaagtaaatcagattgnnnnnnntaaataaataaaggaatcactatagagttgcaatcaccatggagaacttctggaaccaagaaat |
204 |
Q |
| |
|
||||||| | |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298265 |
ctagaag----tgagattgaaaaaaataaataaaaaaaggaatcactatagagttgcaatcaccatggagaacttctggaaccaagaaat |
298180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University