View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_113 (Length: 222)
Name: NF3365_low_113
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_113 |
 |  |
|
| [»] scaffold0239 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0239 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0239
Description:
Target: scaffold0239; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 5214 - 5025
Alignment:
| Q |
14 |
tgagatgaatgctgcattaactaaacccaatcccccttgggcctatgttcatacataatagtttattctgcctcaattatactaaaatttgtagtataaa |
113 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
5214 |
tgagatgaatgctacattaactaaacccaatccccattgggcctatgttcatacataattgtttattctgcctcaattgtactaaaatttatagtataaa |
5115 |
T |
 |
| Q |
114 |
ggcaacatataaacgatgtctaaaaaagaagaatatacagttgcaattatgtttacacttacgataattagaaacaatagctagccggaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5114 |
ggcaacatataaacgatgtctaaaaaagaagaatatacagttgcaattatgtttacacttacgataattagaaacaatagctagccggaa |
5025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University