View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_118 (Length: 210)
Name: NF3365_low_118
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_118 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 3 - 196
Target Start/End: Complemental strand, 44560865 - 44560673
Alignment:
| Q |
3 |
gcggtgctctagagagcgtttgaagatgtaggctgttcacggatacaagtgatgctcgcaacctttttgatctctaatttataataatggacctagagtt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44560865 |
gcggtgctctagagagcgtttgaagatgtaggctgttcacgg-tacaagtgatgcttgcaacctttttgatctctaatttataataatggacctagagtt |
44560767 |
T |
|
| Q |
103 |
tatgagaggttggatagagatttgagttatgatctttggagaattgatttccctaatggtttagtcaaaactcttctgcaggtggccttttatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44560766 |
tatgagaggttggatagagatttgagttatgatctttggagaattgatttccctaatggtttagtcaaaactcttctgcaggtggccttttatg |
44560673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University