View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3365_low_15 (Length: 458)

Name: NF3365_low_15
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3365_low_15
NF3365_low_15
[»] chr1 (2 HSPs)
chr1 (402-450)||(9113738-9113786)
chr1 (19-67)||(9113787-9113835)


Alignment Details
Target: chr1 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 402 - 450
Target Start/End: Complemental strand, 9113786 - 9113738
Alignment:
402 aaatatttaattaatactatgtaatttctttttccacgttcttcatctc 450  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
9113786 aaatatttaattaatactatgtaatttctttttccacgttcttcatctc 9113738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 9113835 - 9113787
Alignment:
19 gtttctttcttggcttggtggaaagaaaaatttaagttaccacgaggtc 67  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
9113835 gtttctttcttggcttggtggaaagaaaaatttaagttaccacgaggtc 9113787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University