View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_32 (Length: 352)
Name: NF3365_low_32
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 10 - 214
Target Start/End: Original strand, 41427314 - 41427518
Alignment:
| Q |
10 |
aatatatatgaattgcggtatggttctttcttacactggacataagnnnnnnnntcttgctcttggccaaatactgaccattatgtgttggttccacagt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41427314 |
aatatatatgaattgcggtatggttctttcttacactggacataagaaaaaaaatcttgctcttggccaaatactgaccattatgtgttggttccacagt |
41427413 |
T |
|
| Q |
110 |
ttgtcccatacattctactgtcctcttgttgtgtatctgtaagaattttcatgttgtaatgcttgcttttatttgagtcatatgcatgcaagtgtgccat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41427414 |
ttgtcccatacattctactgtcctcttgttgtgtatctgtaagaattttcatgctgtaatgcttgcttttatttgagtcatatgcatgcaagtgtgccat |
41427513 |
T |
|
| Q |
210 |
accag |
214 |
Q |
| |
|
||||| |
|
|
| T |
41427514 |
accag |
41427518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 306 - 334
Target Start/End: Original strand, 41427599 - 41427627
Alignment:
| Q |
306 |
cttggttattcacatggtgggtgacgctt |
334 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41427599 |
cttggttattcacatggtgggtgacgctt |
41427627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University