View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_44 (Length: 328)
Name: NF3365_low_44
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 25296282 - 25295971
Alignment:
| Q |
1 |
acccatctcagaaattcaagcctggggctttaagtgatgaatacgttgaaaggctgagaagaggaccgataggacaaggcaaacttggtatctgtggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296282 |
acccatctcagaaattcaagcctggggctttaagtgatgaatacgttgaaaggctgagaagaggaccgataggacaaggcaaacttggtatctgtggaga |
25296183 |
T |
|
| Q |
101 |
gtgtttcatggagaaaattacagggattgatgctgatttccatttgtgctttggtgataaggaaattttagggtttcgaacaactgcgggtccgatttcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296182 |
gtgtttcatggagaaaattacagggattgatgctgatttccatttgtgctttggtgataaggaaattttagggtttcgaacaactgcgggtccgatttcc |
25296083 |
T |
|
| Q |
201 |
cggccggtgagaagttccggcaagaatggtcactgatttgttcggtgcgtttcttttttattttcttggtgcaatgcaatctgtttcttggtccatataa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
25296082 |
cggccggtgagaagttccggcaagaatggtcactgatttgttcggtgcgtttcttttttattttcttggtacaatggaatctgtttcttggtccatataa |
25295983 |
T |
|
| Q |
301 |
aaatttgttagt |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25295982 |
aaatttgttagt |
25295971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University