View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_60 (Length: 285)
Name: NF3365_low_60
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 275
Target Start/End: Original strand, 47726550 - 47726807
Alignment:
| Q |
18 |
catgcaccaatggttgttctccttccttgtatacccataccttgaatctcttcaccatctccttgtggctcctggtttaggggaaaacatattattgtac |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47726550 |
catgcaccaatggttgctctccttccttgtatacccataccttgaatctcttcaccatctccttgtggctcctggtttaggggaaaacatattattgtac |
47726649 |
T |
|
| Q |
118 |
aagtataaccaaactggtttagcggaaaagcatagatttgaaattgttataattaaacttaactggtgaaaagcatgtggattcaagtaaatggaccctt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47726650 |
aagtataaccaaactggtttagctgaaaagcatagatttgaaattgttataattaaacttaactggtgaaaagcatgtggattcaagtaaatggaccctt |
47726749 |
T |
|
| Q |
218 |
ttggaacaaaacnnnnnnncatggtggttgtggacttcttgaaccgaattgctctctg |
275 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
47726750 |
ttggaacaaaactctgtttcatgttggttgtggacttcttggaccgaattgctctctg |
47726807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 91
Target Start/End: Original strand, 47729137 - 47729200
Alignment:
| Q |
28 |
tggttgttctccttccttgtatacccataccttgaatctcttcaccatctccttgtggctcctg |
91 |
Q |
| |
|
|||||| |||||||| | ||||||||| | ||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
47729137 |
tggttgctctccttcttggtatacccaaatcttcaatctcttcaccatttccatgtggctcctg |
47729200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 172 - 228
Target Start/End: Original strand, 47729513 - 47729569
Alignment:
| Q |
172 |
aaacttaactggtgaaaagcatgtggattcaagtaaatggacccttttggaacaaaa |
228 |
Q |
| |
|
||||||||||| |||||||||| |||||| ||||||||||||| |||| |||||| |
|
|
| T |
47729513 |
aaacttaactgatgaaaagcatatggatttctgtaaatggaccctcttgggacaaaa |
47729569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University