View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_61 (Length: 284)
Name: NF3365_low_61
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 80 - 263
Target Start/End: Complemental strand, 45389977 - 45389793
Alignment:
| Q |
80 |
tatcaatactactataatccatccatgaatttgtatgcatacccagaaattggatatcctgcatacccagctgcttactatcaagcataccctccaccgc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45389977 |
tatcaatactactataatccatccatgaatttgtatgcatacccagaaattggatatcctgcatacccagctgcttactatcaagcataccctccaccac |
45389878 |
T |
|
| Q |
180 |
cggcgccggcgccacaaatgttcagtgatgagaacccaaatgcttgcagcgtcatgtgaaattgcaaatttgag-aacatcaaag |
263 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45389877 |
cgccgccggcgccacaaatgttcagtgatgagaacccaaatgcttgcagcgtcatgtgaaattgcaaatttgagaaacatcaaag |
45389793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 191 - 239
Target Start/End: Complemental strand, 45385820 - 45385772
Alignment:
| Q |
191 |
ccacaaatgttcagtgatgagaacccaaatgcttgcagcgtcatgtgaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
45385820 |
ccacaaatgttcagtgatgagaacccaaatgcttgctgtgtcatgtgaa |
45385772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 80 - 135
Target Start/End: Original strand, 31559288 - 31559343
Alignment:
| Q |
80 |
tatcaatactactataatccatccatgaatttgtatgcatacccagaaattggata |
135 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
31559288 |
tatcaatactcctataatccatccatggatttatatgcatacccagaaattggata |
31559343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 80 - 129
Target Start/End: Original strand, 41610796 - 41610845
Alignment:
| Q |
80 |
tatcaatactactataatccatccatgaatttgtatgcatacccagaaat |
129 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
41610796 |
tatcaaaactactataattcatccatgaatttatatgcatacccagaaat |
41610845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 191 - 238
Target Start/End: Original strand, 21269792 - 21269839
Alignment:
| Q |
191 |
ccacaaatgttcagtgatgagaacccaaatgcttgcagcgtcatgtga |
238 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
21269792 |
ccacaaatgtttagtgatgagaatccaaatgcttgcattgtcatgtga |
21269839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 88 - 135
Target Start/End: Original strand, 15632771 - 15632818
Alignment:
| Q |
88 |
ctactataatccatccatgaatttgtatgcatacccagaaattggata |
135 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
15632771 |
ctactataatccatccatggatttatatgcctacccagaaattggata |
15632818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 80 - 129
Target Start/End: Complemental strand, 36255512 - 36255465
Alignment:
| Q |
80 |
tatcaatactactataatccatccatgaatttgtatgcatacccagaaat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
36255512 |
tatcaatactactataatccatccatgaatt--tatacatacccagaaat |
36255465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 88 - 135
Target Start/End: Original strand, 15601473 - 15601520
Alignment:
| Q |
88 |
ctactataatccatccatgaatttgtatgcatacccagaaattggata |
135 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||||||||||| |||| |
|
|
| T |
15601473 |
ctactataatccatccatggatttatatgcctacccagaaattagata |
15601520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University