View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_73 (Length: 253)
Name: NF3365_low_73
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_73 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 16 - 114
Target Start/End: Complemental strand, 24541986 - 24541888
Alignment:
| Q |
16 |
ataaagacagagaaagaaataattttgagaattgcaaagatgtccttcagaatttgcacctttatcaaacatgtcaataaacagaatacaagaattata |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
24541986 |
ataaagacagagaaagaaataattttgagaattgcaaagatgtccttcagaatttgcacctttatgaaacatgtcaataaacagaatacaataattata |
24541888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 176 - 253
Target Start/End: Complemental strand, 24541828 - 24541751
Alignment:
| Q |
176 |
gagtgtaaatatataccataccatatgtatacgcttcctttaaaaaataagaaacgtatactctccctggtactcaaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
24541828 |
gagtgtaaatatataccataccatatgtatacgcttcctttaaaaaataaaaaacgtatactctccccggtactcaaa |
24541751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 41536654 - 41536707
Alignment:
| Q |
20 |
agacagagaaagaaataattttgagaattgcaaagatgtccttcagaatttgca |
73 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41536654 |
agacagaacaagaaataattttgacaattgcaaagatgtccttcagaatttgca |
41536707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 24 - 72
Target Start/End: Original strand, 20963249 - 20963297
Alignment:
| Q |
24 |
agagaaagaaataattttgagaattgcaaagatgtccttcagaatttgc |
72 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
20963249 |
agagcaagaaataattttgacaattgcaaagatatccttcagaatttgc |
20963297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University