View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_78 (Length: 250)
Name: NF3365_low_78
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_78 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 4749747 - 4749528
Alignment:
| Q |
14 |
acctgtgaaagatatttcatttgcctaatttccgtatgtgtaattcctttttgatcggaaggccttcttgccataatctcttcttgttctttctgaaagg |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749747 |
acctgagaaagatatttcatttgcctaatttccgtatgtgtaagtcctttttgatcggaaggccttcttgccataatctcttcttgttctttctgaaagg |
4749648 |
T |
 |
| Q |
114 |
gttcatagttttgtttgttnnnnnnnnnnnncagtaacaaattttgaaaatgccacattaattaatagtattaaaaccttggctctttcgaagacatgtg |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749647 |
gttcatagttttgtttgtt-aaaaaaaaaaacagtaacaaattttgaaaatgccacattaattaatagtattaaaaccttggctctttcgaagacatgtg |
4749549 |
T |
 |
| Q |
214 |
gatgattagtgaggttgataa |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4749548 |
gatgattagtgaggttgataa |
4749528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 14 - 112
Target Start/End: Complemental strand, 4758293 - 4758195
Alignment:
| Q |
14 |
acctgtgaaagatatttcatttgcctaatttccgtatgtgtaattcctttttgatcggaaggccttcttgccataatctcttcttgttctttctgaaag |
112 |
Q |
| |
|
|||| ||||||||||| ||||||| |||||||| || | | | |||||||||| |||||||||| || |||| |||||||||||||||||||||||| |
|
|
| T |
4758293 |
acctttgaaagatattgcatttgcttaatttccttaaggttcagtcctttttgagtggaaggccttgtttccatgatctcttcttgttctttctgaaag |
4758195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University