View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3365_low_89 (Length: 243)
Name: NF3365_low_89
Description: NF3365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3365_low_89 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 15 - 225
Target Start/End: Original strand, 26287747 - 26287957
Alignment:
| Q |
15 |
cacagaactgccgtgatgacgtcggcgactgaaccagaagaacctccaacagcttcaacaactcgaactagatggagatccgtcgaaccaccggcgcaca |
114 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26287747 |
cacataactaccgtgatgacgtcggcgactgaaccagaaaaacctccaatagcttcagcaactcgaactagatggagatccgtcgaaccaccggcgcacc |
26287846 |
T |
|
| Q |
115 |
aaccggacagatcggagtacgccaagaacaacctgaacctccgccgaaagaacatgcacgaaggtggtgcggatggcaagccgatcctcgcaccacccac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26287847 |
aaccggacagatcggagtacgccaagaacaacctgaacctctgccgaaagaacatgcacgaaggtggtgcgaatggcaagccgatcctcgcaccacccac |
26287946 |
T |
|
| Q |
215 |
cactatgatct |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
26287947 |
cactatgatct |
26287957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University