View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3366_low_2 (Length: 258)
Name: NF3366_low_2
Description: NF3366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3366_low_2 |
 | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 35 - 233
Target Start/End: Original strand, 30427 - 30625
Alignment:
| Q |
35 |
gaaacaatagtcactttgatagtggaaatggtttcgccttcacaaatagcgctttctaattatgtaattttttcttatcttatcatctctaattagcttc |
134 |
Q |
| |
|
||||||| ||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30427 |
gaaacaacagtcactttcatagtggaaatgatttcaccttcacaaatagcgctttctaattatgtacttttttcttatcttatcatctctaattagcttc |
30526 |
T |
|
| Q |
135 |
cattgaattacataacgccataaaggtgttagctta--gtgataagagtttaacgacaaagttctctcagggtcggctgtaaaatagtcattagtgtttt |
232 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| || |||| | | || |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30527 |
cattgaattacataatgccat-aaggtgttagcttaacgtcataa-cctcaagagataaagttctctcagggtcgattgtaaaatagtcattagtgtttt |
30624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 65635 - 65704
Alignment:
| Q |
13 |
gtagcataggtatcatggttatgaaacaatagtcactttgatagtggaaatggtttcgccttcacaaata |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65635 |
gtagcataggtatcatggttatgaaacaatagtcactttgatagtggaaatggtttcgccttcacaaata |
65704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University