View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367-Insertion-11 (Length: 173)
Name: NF3367-Insertion-11
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367-Insertion-11 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 6e-85; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 6e-85
Query Start/End: Original strand, 7 - 173
Target Start/End: Original strand, 18028357 - 18028523
Alignment:
| Q |
7 |
aacaccacttctgagtttaacatcaacatcattcattagtttcttttgcttgtgaaattcaaaaaacataataaaatgaaactcaacagcatttcatttt |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18028357 |
aacaccacttctgagtttaatatcaacatcattcattagtttcttttgcttgtgaaattcaaaaaacataataaaatgaaactcaacagcatttcatttt |
18028456 |
T |
|
| Q |
107 |
tgttcaagcttttggtacttcaatatctatcaattcaatgtctttctgatgattttgatttcttcta |
173 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18028457 |
tgttcaagcttttgatacttcaatatctatcaattcaatgtctttctgatgattttgatttcttcta |
18028523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 68 - 173
Target Start/End: Original strand, 18034278 - 18034386
Alignment:
| Q |
68 |
aaaaacataataaaatgaaactcaacagcatttcatttttgttcaagcttttggtacttcaatatctatcaattcaatgtctttctg---atgattttga |
164 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||| || ||||||| ||||||| | |||||||| |
|
|
| T |
18034278 |
aaaagcataagaaaatgaaactcagcagcatttcatttttgtccaagcttttaatacttcaatatctttctgttcaatgcctttctgctcaggattttga |
18034377 |
T |
|
| Q |
165 |
tttcttcta |
173 |
Q |
| |
|
||||||||| |
|
|
| T |
18034378 |
tttcttcta |
18034386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 6e-17
Query Start/End: Original strand, 69 - 153
Target Start/End: Original strand, 18052046 - 18052130
Alignment:
| Q |
69 |
aaaacataataaaatgaaactcaacagcatttcatttttgttcaagcttttggtacttcaatatctatcaattcaatgtctttct |
153 |
Q |
| |
|
||||||||| ||||||||| | | ||||||||||||||||| ||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
18052046 |
aaaacataagaaaatgaaattaagcagcatttcatttttgtccaagcttttaatacttcaatatctatcttttcaatgcctttct |
18052130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University