View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367-Insertion-12 (Length: 148)
Name: NF3367-Insertion-12
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367-Insertion-12 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 3e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 6 - 148
Target Start/End: Complemental strand, 40786005 - 40785862
Alignment:
| Q |
6 |
cattaacaccacaaatctcatcttctacttcaacctcctcatccttcacttctagatcatcttctccatcttctatgaa-aaaatacttggcattgaagg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40786005 |
cattaacaccacaaatctcatcttctacttcaacctcctcatccttcacttctagatcatcttctccatcttctatgaaaaaaatacttggcattgaagg |
40785906 |
T |
|
| Q |
105 |
acattttttcaccttatccactttactaacaccaacatcaacat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40785905 |
acattttttcaccttatccactttactaacaccaacatcaacat |
40785862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 4e-36
Query Start/End: Original strand, 6 - 141
Target Start/End: Complemental strand, 40793757 - 40793621
Alignment:
| Q |
6 |
cattaacaccacaaatctcatcttctacttcaacctcctcatccttcacttctagatcatcttctccatcttctatgaaaaa-atacttggcattgaagg |
104 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |||| ||||||||||| ||||||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
40793757 |
cattaacaccataaatctcatcttcaacttcaacctcttcattcttcacttctaaatcatcttctccatcttctataaaaaagatacttgccattgaagg |
40793658 |
T |
|
| Q |
105 |
acattttttcaccttatccactttactaacaccaaca |
141 |
Q |
| |
|
||| ||||||| ||| || ||||| ||||||||||| |
|
|
| T |
40793657 |
acactttttcatcttttcaacttttgtaacaccaaca |
40793621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University