View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367-Insertion-13 (Length: 99)
Name: NF3367-Insertion-13
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367-Insertion-13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 4845398 - 4845310
Alignment:
| Q |
8 |
cttgcttgctggtgaacaagctagaagatcaaagaagagtaaagagagtaatgaaaaaactgaggccaaagagtgtaacaacaaagttg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
4845398 |
cttgcttgctggtgaacaagctagaagaacaaagaagagtaaagagagtaatgaaaaaactgaggccaacgagtgtaacaacaatgttg |
4845310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University