View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_high_28 (Length: 236)
Name: NF3367_high_28
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_high_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 74 - 221
Target Start/End: Complemental strand, 34432102 - 34431955
Alignment:
| Q |
74 |
cgtcgccgccgtaatggtaacctgcttcttctcttccgatcatttctcaatgcgcgtttcgattttcaactctatcgtttgaatcactaacttcaatttc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432102 |
cgtcgccgccgtaatggtaacctgcttcttctcttccgatcatttctcaatgcgcatttcgattttcaactctatcgtttgaatcactaacttcaatttc |
34432003 |
T |
|
| Q |
174 |
ttcacactttagttttcttcaatttcttcattttcaaccgattaaatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432002 |
ttcacactttagttttcttcaatttcttcattttcaaccgattaaatc |
34431955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University