View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_high_29 (Length: 233)
Name: NF3367_high_29
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 16138366 - 16138568
Alignment:
| Q |
19 |
gttatatcaaatatgaatatgaagtttgaatagagagtatatcctttatatcaaatatgcaaaactaatgtagtatgtgtaatcatattttcattgtagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
16138366 |
gttatatcaaatatgaatatgaagtttgaatagagagtatatcctttatatcaaatatgcaaaacaaatgtaatatgtgtaatcatattttcattgtagc |
16138465 |
T |
 |
| Q |
119 |
cgaaaaattgtcgaacaccagtgatgcatgtcgttacgcgcatccatgcatgcaacctgatccaccatcacttttgtgagtttttctaccattgtatatt |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16138466 |
cgaaaaattgtcgaacaacagtgatgcatgtcgttacacgcatccatgcatgcaacctgatccaccatcacttttgtgagtttttctaccattgtatttt |
16138565 |
T |
 |
| Q |
219 |
ctt |
221 |
Q |
| |
|
||| |
|
|
| T |
16138566 |
ctt |
16138568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University