View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_high_30 (Length: 221)
Name: NF3367_high_30
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 50758 - 50571
Alignment:
| Q |
17 |
aggcagcagaggatctcttgcccccttgcaatactaacatctgagcttacatgattctgtcctcacaaactcttgaggatgtagcaaaccacatctcatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
50758 |
aggcagcagaggatctcttgcccccttgcaatactaacatctgagcttacatgattctgtcctcacaaactcttaaggaagtagcaaaccacatctcatc |
50659 |
T |
 |
| Q |
117 |
tattactgtcttttatccaacgtttaatgggagtagataaatataacgactttctgatgcacaaaaactccagaactttacttccaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50658 |
tattactgtcttttatccaacgtttaatgggagtagataaatataacgactttctgatgcacaaaaactccagaactttacttccaac |
50571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University