View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_low_17 (Length: 262)
Name: NF3367_low_17
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 47318140 - 47317887
Alignment:
| Q |
1 |
atcaggcaatcagctaaacccaaaacgaaaacaagtggaaaaaaccttactgtgcataattccccgccaagaaaaaaccacgagaatatttcaattcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47318140 |
atcaggcaatcagctaaacccaaaacgaaaacaagtggaaaaaaccttactgtgcataatcccccgccaagaaaaaaccacgagaatatttcaattcaag |
47318041 |
T |
 |
| Q |
101 |
tttgtccctattaacaaaattgatgagagagtgtcctgcagcagaaaagcacaactgacaaccttgctgcattatctgcctccagcaaggtatcagtatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47318040 |
tttgtccctattaacaaaattgatgagacagtgtcctgcagcagaaaagcacaactgacaaccttgctgcattatctgcctccagcaaggtatcagtatg |
47317941 |
T |
 |
| Q |
201 |
gataaaagtcttgaaattagacaactaggctaatgcagaaatttcccctttgct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47317940 |
gataaaagtcttgaaattagacaactaggctaatgcagaaatttcccctttgct |
47317887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University