View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_low_19 (Length: 252)
Name: NF3367_low_19
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_low_19 |
 |  |
|
| [»] scaffold0186 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0186 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0186
Description:
Target: scaffold0186; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 24972 - 25214
Alignment:
| Q |
1 |
tatgaaactacaacttttttctcaagtttccttaattgtgatctaataaggagttatgaaactcgcttttgctctttattttctccaaataccttacaac |
100 |
Q |
| |
|
||||||||||| |||||||| |||||| ||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
24972 |
tatgaaactacgacttttttttcaagtgtccttaattgtgatctaataaggagttgtgaaactcacttttactctttattttctccaaatacgttacaac |
25071 |
T |
 |
| Q |
101 |
tcccatctcctaattgga-agcttgttgaaactctagctgaaattgaatttcaaacaccaattatcaaggagatttcaccttattttacgagcctttatt |
199 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25072 |
tcccatctcctagttggacagcttgttgaaactctagctgaaattgaatttcaagcaccaattatcaaggagatttcaccatattttacgagcctttatt |
25171 |
T |
 |
| Q |
200 |
attctttttcttgattgccacttacattttatatgtgtctgtg |
242 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
25172 |
attcattttcttgatttccacttacattttatatgtgtttgtg |
25214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University