View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_low_20 (Length: 251)
Name: NF3367_low_20
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 44043141 - 44043057
Alignment:
| Q |
1 |
tccatcgaaaggagtagtttcaatacgggagacattgaagagcaccatggttgattgattacctgattgaagaaaaacgaaatct |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44043141 |
tccatcgaaaggagtagtttcaatacgggagacattgaagagcaccatggttgattgattacctgattgaagaaaaacgaaatct |
44043057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 189 - 242
Target Start/End: Complemental strand, 44042915 - 44042862
Alignment:
| Q |
189 |
gagtgagtgagtgagaggttccgtaagaaaaatgatttgagattgtgtctgtgc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44042915 |
gagtgagtgagtgagaggttccgtaagaaaaatgatttgagattgtgtttgtgc |
44042862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 132 - 180
Target Start/End: Complemental strand, 44043002 - 44042954
Alignment:
| Q |
132 |
gtggtagttattaatattaataggaatgaagaaaagatagagaaatgaa |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44043002 |
gtggtagttattaatattaataggaatgaagaaaagatagagaaatgaa |
44042954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University