View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3367_low_20 (Length: 251)

Name: NF3367_low_20
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3367_low_20
NF3367_low_20
[»] chr8 (3 HSPs)
chr8 (1-85)||(44043057-44043141)
chr8 (189-242)||(44042862-44042915)
chr8 (132-180)||(44042954-44043002)


Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 44043141 - 44043057
Alignment:
1 tccatcgaaaggagtagtttcaatacgggagacattgaagagcaccatggttgattgattacctgattgaagaaaaacgaaatct 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44043141 tccatcgaaaggagtagtttcaatacgggagacattgaagagcaccatggttgattgattacctgattgaagaaaaacgaaatct 44043057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 189 - 242
Target Start/End: Complemental strand, 44042915 - 44042862
Alignment:
189 gagtgagtgagtgagaggttccgtaagaaaaatgatttgagattgtgtctgtgc 242  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
44042915 gagtgagtgagtgagaggttccgtaagaaaaatgatttgagattgtgtttgtgc 44042862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 132 - 180
Target Start/End: Complemental strand, 44043002 - 44042954
Alignment:
132 gtggtagttattaatattaataggaatgaagaaaagatagagaaatgaa 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
44043002 gtggtagttattaatattaataggaatgaagaaaagatagagaaatgaa 44042954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University