View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_low_22 (Length: 245)
Name: NF3367_low_22
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 34455728 - 34455504
Alignment:
| Q |
1 |
ctatgtcaggatagacttacatttcctttccttaagagtttgattattttttggttcagattcatggcaatgttgaaatgtggattcgttgtcttattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34455728 |
ctatgtcaggatagacttacatttcctttccttaagagtttgattattctctggttcagattcatggcaatgttgaaatgtggattcattgtcttattct |
34455629 |
T |
|
| Q |
101 |
tggatcttcctnnnnnnnnnnnnnnnnnnctttcctttccaaatctcgtgtcctacttggaacttgctatctttagatgattcatcaatttacggcattt |
200 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34455628 |
tggttcttcctaaaaaaaaaaaaaaa---ctttcctttccaaatctcgtgtcctacttggaacttgctatctttagatgattcatcaatttacggcattt |
34455532 |
T |
|
| Q |
201 |
caattagtccatcgttattattgttttc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34455531 |
caattagtccatcgttattattgttttc |
34455504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 84
Target Start/End: Complemental strand, 30158832 - 30158758
Alignment:
| Q |
10 |
gatagacttacatttcctttccttaagagtttgattattttttggttcagattcatggcaatgttgaaatgtgga |
84 |
Q |
| |
|
||||||||||| |||||||| |||| ||| ||||| ||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
30158832 |
gatagacttacctttccttttcttaggaggttgatcattacctggttcagattcatggcagtgttgagatgtgga |
30158758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University