View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3367_low_23 (Length: 243)
Name: NF3367_low_23
Description: NF3367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3367_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 30 - 138
Target Start/End: Original strand, 41367569 - 41367681
Alignment:
| Q |
30 |
aataatgtttgttgttggtaataatcgatgtaa----aaagctttattgaatgttgttggaatgaaaattaaggaaaggaatcgcacatgatcaggaaca |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41367569 |
aataatgtttgttgttggtaataatcgatgtaattaaaaagctttattgaatgttgttggaatgaaaattaaggaaaggaatcgcacatgatcagcaaca |
41367668 |
T |
 |
| Q |
126 |
actttaatttgag |
138 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41367669 |
actttaatttgag |
41367681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 172 - 243
Target Start/End: Original strand, 41367675 - 41367746
Alignment:
| Q |
172 |
atttaagcaaaattttgtggaaatgacagaaaacactgctgtggattaagcagagaagagaatcaatgagct |
243 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41367675 |
atttgagcaaaattttgtggaaatgacagaaaacactgctatggattaagcagagaagagaatcaatgagct |
41367746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 243
Target Start/End: Original strand, 44281519 - 44281567
Alignment:
| Q |
195 |
tgacagaaaacactgctgtggattaagcagagaagagaatcaatgagct |
243 |
Q |
| |
|
|||||||||||| ||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
44281519 |
tgacagaaaacatagctatggattcagcagagaagagactcaatgagct |
44281567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University